SpletA Myc tag is a polypeptide protein tag derived from the c-Myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein ... SpletSchematic of pCMV3-SP-N-His Multiple Cloning Sites Vector Name pCMV3-SP-N-His Vector Size 6149bp Vector Type Mammalian Expression Vector Expression Method …
pCMV3-SP-N-Flag Vector Sino Biological
SpletEnhanced CMV promoter Vector pCMV3-SP-N-His Restriction Sites KpnI + XbaI (6kb + 0.39kb) Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC Sequencing Primers T7 ( 5' TAATACGACTCACTATAGGG 3' ) BGH ( 5' TAGAAGGCACAGTCGAGG 3' ) Quality Control The plasmid is confirmed by full-length … SpletpCMV3-SP-N-His Mammalian expression vector: Protein expression will be driven by the CMV promoter with N terminally fused His tag. The vector is specially suitable for … Here you can find our complete kits for gene knockout via CRISPR.All products … Expression vectors, like cloning vectors, are used for horizontal gene … A plasmid is a small, circular, double-stranded DNA molecule within a cell that … antibodies-online Inc. Jones Boulevard 321 Limerick, PA 19464 United States Phone … mario paint crossword clue
pCMV3-N-HA Vector Sino Biological
Spletpcmv3-sp-n-ha Mammalian expression vector: Protein expression will be driven by the CMV promoter with N terminally fused HA Tag. The vector is specially suitable for expression … SpletSchematic of pCMV3-SP-N-His Multiple Cloning Sites Vector Name pCMV3-SP-N-His Vector Size 6149bp Vector Type Mammalian Expression Vector Expression Method … SpletFor galectin-1 overexpression, 0.7μg pCMV3-SP-N-His-Gal-1 plasmid or negative control pCMV3-SP-N-His plasmid and 20μl HiPerFect transfection reagent were diluted separately in 40μl OPTI-MEM at room temperature for 5 minutes. The two mixtures were re-mixed and incubated for 30 minutes. natwest bankline security